|
Shanghai GenePharma
shrna against atg5 Shrna Against Atg5, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/shrna against atg5/product/Shanghai GenePharma Average 90 stars, based on 1 article reviews
shrna against atg5 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Bioneer Corporation
sirna for mouse atg7 Sirna For Mouse Atg7, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sirna for mouse atg7/product/Bioneer Corporation Average 90 stars, based on 1 article reviews
sirna for mouse atg7 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
OriGene
short hairpin rnas shrnas Short Hairpin Rnas Shrnas, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/short hairpin rnas shrnas/product/OriGene Average 90 stars, based on 1 article reviews
short hairpin rnas shrnas - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
atg 5 sirna Atg 5 Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/atg 5 sirna/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
atg 5 sirna - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
human atg5 sirna Human Atg5 Sirna, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human atg5 sirna/product/Cell Signaling Technology Inc Average 94 stars, based on 1 article reviews
human atg5 sirna - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
atg5 ![]() Atg5, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/atg5/product/Cell Signaling Technology Inc Average 96 stars, based on 1 article reviews
atg5 - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
small interfering rna (sirna) oligonucleotides against atg5 ![]() Small Interfering Rna (Sirna) Oligonucleotides Against Atg5, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/small interfering rna (sirna) oligonucleotides against atg5/product/Cell Signaling Technology Inc Average 90 stars, based on 1 article reviews
small interfering rna (sirna) oligonucleotides against atg5 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Ribobio co
sirna targeting atg5 mrna (agugaacaucugagcuacccggaua) ![]() Sirna Targeting Atg5 Mrna (Agugaacaucugagcuacccggaua), supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sirna targeting atg5 mrna (agugaacaucugagcuacccggaua)/product/Ribobio co Average 90 stars, based on 1 article reviews
sirna targeting atg5 mrna (agugaacaucugagcuacccggaua) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
atg5 shrna ![]() Atg5 Shrna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/atg5 shrna/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
atg5 shrna - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
atg5 sirna ![]() Atg5 Sirna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/atg5 sirna/product/Thermo Fisher Average 90 stars, based on 1 article reviews
atg5 sirna - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
si-atg5 #s18160 ![]() Si Atg5 #S18160, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/si-atg5 #s18160/product/Thermo Fisher Average 90 stars, based on 1 article reviews
si-atg5 #s18160 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Ribobio co
sfxn1 sirna ![]() Sfxn1 Sirna, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sfxn1 sirna/product/Ribobio co Average 90 stars, based on 1 article reviews
sfxn1 sirna - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cellular and Molecular Immunology
Article Title: Cellular response to influenza virus infection: a potential role for autophagy in CXCL10 and interferon-alpha induction
doi: 10.1038/cmi.2010.25
Figure Lengend Snippet: Knockdown of Atg5 protein by siRNA oligos. Human blood macrophages were transfected with siAtg5 or siCtrl at 100 and 200 nM. At 48 hour post-transfection, whole-cell lysates were harvested and Atg5 expression was measured by western blot with antibodies specific to Atg5. Actin was used as a loading control. Densities of the protein bands were determined with Bio-Rad Quantity One imaging software. The Atg5 intensity values were normalized to the corresponding actin levels. The values in parentheses are the relative normalized intensities compared to those of the siCtrl-transfected cells. The results shown are representative figures from three independent experiments. siAtg5, small interfering RNA oligos specific to Atg5; siCtrl, non-targeting control oligos; siRNA, small interfering RNA.
Article Snippet: Specific antibodies against LC3B,
Techniques: Knockdown, Transfection, Expressing, Western Blot, Control, Imaging, Software, Small Interfering RNA
Journal: Cellular and Molecular Immunology
Article Title: Cellular response to influenza virus infection: a potential role for autophagy in CXCL10 and interferon-alpha induction
doi: 10.1038/cmi.2010.25
Figure Lengend Snippet: Involvement of Atg5 in H1N1 and H9N2/G1 virus-induced autophagy. siAtg5- or siCtrl-transfected macrophages were mock-infected or infected with H1N1 or H9N2/G1. Atg5 and LC3B II levels were examined by western blot. Actin was used as a loading control. Densities of the protein bands were determined with Bio-Rad Quantity One imaging software. The values in parentheses are the relative intensities of Atg5 or LC3B II levels compared to those of actin. The results shown are representative figures from three independent experiments. siAtg5, small interfering RNA oligos specific to Atg5; siCtrl, non-targeting control oligos; siRNA, small interfering RNA.
Article Snippet: Specific antibodies against LC3B,
Techniques: Virus, Transfection, Infection, Western Blot, Control, Imaging, Software, Small Interfering RNA
Journal: Cellular and Molecular Immunology
Article Title: Cellular response to influenza virus infection: a potential role for autophagy in CXCL10 and interferon-alpha induction
doi: 10.1038/cmi.2010.25
Figure Lengend Snippet: Inhibition of autophagy suppressed influenza-induced CXCL10 and IFN-α expression. Macrophages were pre-treated with 3-MA (10 mM) before infection with H1N1 ( a ) or H9N2/G1 ( b ). CXCL10 mRNA expression at 3 h.p.i. was examined by TaqMan gene expression assay; n =3. Macrophages were transfected with siAtg5 or siCtrl at 200 nM. At 48 hour post-transfection, cells were infected with H1N1 ( c ) or H9N2/G1 ( d ). The relative CXCL10 mRNA levels were examined at 3 h.p.i. by TaqMan gene expression assay; n =3. Relative mRNA levels of IFN-α1, -α2 and -α8 in siRNA-transfected cells with H9N2/G1 infections were examined by TaqMan gene expression assay ( e ); n =3. Data represent the percentages of CXCL10 or IFN-α expression from 3-MA-treated or siAtg5-transfected cells relative to the mock-treated or siCtrl-transfected cells, respectively. * P <0.05, # P <0.01. h.p.i., hour post-infection; IFN, interferon; siAtg5, small interfering RNA oligos specific to Atg5; siCtrl, non-targeting control oligos; siRNA, small interfering RNA; 3-MA, 3-methyladenine.
Article Snippet: Specific antibodies against LC3B,
Techniques: Inhibition, Expressing, Infection, Gene Expression, Transfection, Small Interfering RNA, Control
Journal: Cellular and Molecular Immunology
Article Title: Cellular response to influenza virus infection: a potential role for autophagy in CXCL10 and interferon-alpha induction
doi: 10.1038/cmi.2010.25
Figure Lengend Snippet: Atg5 knockdown suppressed H9N2/G1-induced CXCL10 and IFN-α protein expression. Macrophages were transfected with siAtg5 or siCtrl at 200 nM. At 48 hour post-transfection, cells were infected with H9N2/G1. Quantities of CXCL10 ( a ) ( n =4) and IFN-α ( b ) ( n =5) in the culture supernatants at 8 h.p.i. were measured by ELISA. The data represent the percentage of CXCL10 and IFN-α expression from siAtg5-transfected cells relative to siCtrl-transfected cells. * P <0.05, # P <0.01. h.p.i., hour post-infection; IFN, interferon; siAtg5, small interfering RNA oligos specific to Atg5; siCtrl, non-targeting control oligos.
Article Snippet: Specific antibodies against LC3B,
Techniques: Knockdown, Expressing, Transfection, Infection, Enzyme-linked Immunosorbent Assay, Small Interfering RNA, Control
Journal: Oncotarget
Article Title: Inhibition of autophagy potentiates pemetrexed and simvastatin-induced apoptotic cell death in malignant mesothelioma and non-small cell lung cancer cells
doi:
Figure Lengend Snippet: Cells were treated with 1 μM pemetrexed and 5 μM simvastatin in the absence or presence of the autophagy inhibitors 1 mM 3-MA A. ATG5 siRNA C. 50 nM bafilomycin A E. and 10 μM E64d/pepstatin A G. The cell lysates were subjected to 12% SDS-PAGE to measure the expression of indicated proteins. B, D, F. and H. Apoptosis was evaluated as described in Figure . The data represent the mean ± SD of three independent experiments. * p < 0.01 compared with the control, ## p < 0.05 compared to the pemetrexed and simvastatin group.
Article Snippet: Pooled small interfering
Techniques: SDS Page, Expressing, Control
Journal: International Journal of Molecular Sciences
Article Title: Inhibition of Autophagy by Deguelin Sensitizes Pancreatic Cancer Cells to Doxorubicin
doi: 10.3390/ijms18020370
Figure Lengend Snippet: Autophagy has a pro-survival role in doxorubicin-induced cell death. ( A , B ) Mia PaCa-2 and Panc-1 cells were treated with doxorubicin (2.5 μM) in the presence or absence of CQ (10 μM). The percentage of Annexin V positive cells was recorded. Cleaved PARP and cleaved caspase-3 levels were also analyzed by western blot; ( C ) Mia PaCa-2 and Panc-1 cells were transfected with siRNA against the essential autophagy gene Atg5 or with a scrambled siRNA. Atg5 mRNA and protein expression levels were detected by real-time quantitative PCR and western blot, respectively. Results are presented as the means ± SD; ( D ) Western blot analysis of autophagic markers (LC3-II and p62) and apoptotic markers (cleaved PARP and cleaved caspase-3) from Mia PaCa-2 and Panc-1 cells transfected with the indicated siRNAs followed by doxorubicin treatment for 24 h; ( E ) Evaluation of apoptosis in Mia PaCa-2 and Panc-1 cells following suppression of autophagy by knockdown of Atg5 and treatment with doxorubicin (2.5 μM) for 24 h. GAPDH from a similarly loaded gel is shown as loading control.
Article Snippet: Mia PaCa-2 and Panc-1 cells were grown in 6-well plates and transfected with 50 nM siRNA using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol.
Techniques: Western Blot, Transfection, Expressing, Real-time Polymerase Chain Reaction